Gene Information: rig-5
| Name | rig-5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C36F7.4 |
| Genetic position | I:3.80 +/- 0.001 cM |
| Genomic position | I: 9565389..9574377 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4300 | rig-5(gk5383[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 8834 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGGCTGAATCCACTTGAATTGCTCGGAGC; Right flanking sequence: GTAATAGCGACGATTGAGCAATGAAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |