Gene Information: irk-2
| Name | irk-2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | M02A10.2 |
| Genetic position | X:-19.51 +/- 0.000 cM |
| Genomic position | X: 702971..714498 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4084 | T27E7.4(gk5171) IV; irk-2(gk5172) X. | Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT. |
| VC4128 | irk-2(gk5210[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTACCTGCAACCGAACATGCGCTTCCGCCA ; Right flanking sequence: TCCGTTGAGCTGTGAAAATATCAGTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |