Gene Information: T01D1.4
| Name | T01D1.4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T01D1.4 |
| Genetic position | II:-15.89 +/- 0.000 cM |
| Genomic position | II: 176997..179093 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3050 | T01D1.4(ve550[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgtctgatgtagaagtttagttgttgtgg ; Right flanking sequence: TGTGGGAGACGACGATCTCCGCATGGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |