Gene Information: lbp-7
| Name | lbp-7 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T22G5.2 |
| Genetic position | V:5.71 +/- 0.001 cM |
| Genomic position | V: 13879552..13880213 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4079 | lbp-7(gk5153[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 774 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTGAAAACTTGACTTCTGTGGTTTGCAAG ; Right flanking sequence: CGAGTGGGAGAGAGAATAATTTATTTTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |