Gene Information: lbp-6
| Name | lbp-6 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | W02D3.5 |
| Genetic position | I:1.30 +/- 0.000 cM |
| Genomic position | I: 6728296..6729376 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4078 | lbp-6(gk5152[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 924 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGAATTGAGAATCTATTCGCGAACGTACT ; Right flanking sequence: TCCAACGAATTCTTGAGACATGGTGATGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |