Gene Information: cpt-5
| Name | cpt-5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F09F3.9 |
| Genetic position | V:5.70 +/- 0.001 cM |
| Genomic position | V: 13873195..13875888 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4054 | cpt-5(gk5128[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 2432 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCAATAAAATGTAGCATTAAGTGTAGCCA ; Right flanking sequence: ATGTATGTTTTCCGAATTATTTTTCGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |