Gene Information: sra-1
Name | sra-1 View on WormBase |
---|---|
Species | C. elegans |
Sequence | AH6.4 |
Genetic position | II:1.49 +/- 0.003 cM |
Genomic position | II: 9520200..9521670 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
RG3002 | sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |