Gene Information: nas-17

Namenas-17 View on WormBase
Species C. elegans
SequenceK03B8.2
Genetic positionV:3.08 +/- 0.000 cM
Genomic positionV: 11398916..11400563

Strains carrying this gene

Strain Genotype Description
RG3035 nas-17(ve535[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 1433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATCACTTCGACATGTTTCTTCGACCATCT ; Right flanking sequence: TACGGAAGCAGCAAGTTGACAATTCATTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.