Gene Information: sra-32

Namesra-32 View on WormBase
Species C. elegans
SequenceB0304.5
Genetic positionII:-4.07 +/- 0.008 cM
Genomic positionII: 4529636..4531980

Strains carrying this gene

Strain Genotype Description
RG3019 sra-32(ve519[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.