Gene Information: sra-22

Namesra-22 View on WormBase
Species C. elegans
SequenceF28C12.7
Genetic positionI:13.95 +/- 0.001 cM
Genomic positionI: 12701439..12702886

Strains carrying this gene

Strain Genotype Description
RG3013 sra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.