Gene Information: sra-22
| Name | sra-22 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F28C12.7 |
| Genetic position | I:13.95 +/- 0.001 cM |
| Genomic position | I: 12701439..12702886 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3013 | sra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |