Gene Information: sra-39
| Name | sra-39 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T21H8.4 |
| Genetic position | X:15.13 +/- 0.000 cM |
| Genomic position | X: 13899033..13903428 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3018 | sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |