Gene Information: sra-39

Namesra-39 View on WormBase
Species C. elegans
SequenceT21H8.4
Genetic positionX:15.13 +/- 0.000 cM
Genomic positionX: 13899033..13903428

Strains carrying this gene

Strain Genotype Description
RG3018 sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.