Gene Information: sra-26
| Name | sra-26 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T19D12.8 |
| Genetic position | II:-0.05 +/- 0.000 cM |
| Genomic position | II: 6649702..6651819 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3016 | sra-26(ve516[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |