Gene Information: oac-19
| Name | oac-19 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F35E2.6 |
| Genetic position | I:9.61 +/- 0.004 cM |
| Genomic position | I: 11707808..11712197 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4370 | oac-19(gk5451[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 3916 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TACTCTCAAGTTGAGATGTGGTTGCCATTA; Right flanking sequence: CAGACAATGACCAGGTATGTGTGAAGATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |