Gene Information: sra-17

Namesra-17 View on WormBase
Species C. elegans
SequenceF28C12.1
Genetic positionI:13.93 +/- 0.003 cM
Genomic positionI: 12688727..12690572

Strains carrying this gene

Strain Genotype Description
RG3011 sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.