Gene Information: sra-17
Name | sra-17 View on WormBase |
---|---|
Species | C. elegans |
Sequence | F28C12.1 |
Genetic position | I:13.93 +/- 0.003 cM |
Genomic position | I: 12688727..12690572 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
RG3011 | sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |