Gene Information: sra-27

Namesra-27 View on WormBase
Species C. elegans
SequenceF18C5.1
Genetic positionII:-0.12 +/- 0.001 cM
Genomic positionII: 6569007..6570701

Strains carrying this gene

Strain Genotype Description
RG3012 sra-27(ve512(LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.