Gene Information: glb-15
Name | glb-15 View on WormBase |
---|---|
Species | C. elegans |
Sequence | F35B12.8 |
Genetic position | V:3.23 +/- 0.001 cM |
Genomic position | V: 11616805..11618273 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4204 | glb-15(gk5289[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGTTTTATTTACGCCATAAAAACCTGCC ; Right flanking sequence: ATGGATGGGCGTTGAAGACGTCTGACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |