Gene Information: ubc-8
| Name | ubc-8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y94H6A.6 |
| Genetic position | IV:-6.75 +/- 0.003 cM |
| Genomic position | IV: 2704741..2707238 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4187 | ubc-8(gk5273[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |