Gene Information: C54E10.3

NameC54E10.3 View on WormBase
Species C. elegans
SequenceC54E10.3
Genetic positionV:18.02 +/- 0.000 cM
Genomic positionV: 18811005..18813481

Strains carrying this gene

Strain Genotype Description
CGC58 C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.