Gene Information: M153.4
| Name | M153.4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | M153.4 |
| Genetic position | X:7.01 +/- 0.000 cM |
| Genomic position | X: 12149924..12151477 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4267 | M153.4(gk5350[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCTAGCAACAAACAATCATGTGCTCCTCCT; Right flanking sequence: GTGGGAAGGAGTAGATCAAAAAGTCAATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |