Gene Information: lron-1
| Name | lron-1 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C44H4.1 |
| Genetic position | X:16.75 +/- 0.000 cM |
| Genomic position | X: 14572719..14576125 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4008 | lron-1(gk5081[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 3289 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGATCACTCATTTCCTTATTCTTTCCAGGT; Right flanking sequence: TTTGGTTTCCTATCCCTTTTCAACAAATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |