Gene Information: lgc-31
| Name | lgc-31 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F21A3.7 |
| Genetic position | V:8.33 +/- 0.001 cM |
| Genomic position | V: 15512765..15522020 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3769 | lgc-31(gk3727[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATGATTATCTGGATCCACCGTTATTTTGGG; Right flanking sequence: AGGTGAGTCGGGTGGAACCTCGAACACGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |