Gene Information: rsp-4
| Name | rsp-4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | EEED8.7 |
| Genetic position | II:-1.78 +/- 0.000 cM |
| Genomic position | II: 5387411..5388836 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3764 | rsp-4(gk3722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 404 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCGTTTCTGTTAGCTATATTCAATTC; Right flanking sequence: TGGTGGTGGACGTAGAAGGTTAGTATACTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |