Gene Information: igcm-4
| Name | igcm-4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y102A11A.8 |
| Genetic position | X:-17.07 +/- 0.000 cM |
| Genomic position | X: 2039397..2046360 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4056 | igcm-4(gk5130[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTATTGTTTCTTTGTTGAATATGGTATG ; Right flanking sequence: TCTTTACCTGCTCTCCATTTTTAGACCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |