Gene Information: decr-1.3
| Name | decr-1.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T05C12.3 |
| Genetic position | II:0.74 +/- 0.001 cM |
| Genomic position | II: 8172229..8173549 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3051 | decr-1.3(ve551[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1260 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCCACGAATAACGTTCTCAACATCTCC ; Right flanking sequence: cgtggaacaccctttttaatctttaaactt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |