Gene Information: sra-29
| Name | sra-29 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F18C5.8 |
| Genetic position | II:-0.12 +/- 0.002 cM |
| Genomic position | II: 6574378..6575747 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3008 | sra-29(ve508[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |