Gene Information: C04C3.6
| Name | C04C3.6 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C04C3.6 |
| Genetic position | IV:-4.42 +/- 0.000 cM |
| Genomic position | IV: 3419813..3422616 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| CGC78 | C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |