Gene Information: C04C3.6

NameC04C3.6 View on WormBase
Species C. elegans
SequenceC04C3.6
Genetic positionIV:-4.42 +/- 0.000 cM
Genomic positionIV: 3419813..3422616

Strains carrying this gene

Strain Genotype Description
CGC78 C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.