Gene Information: lgc-13
| Name | lgc-13 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T01H10.1 |
| Genetic position | X:7.01 +/- 0.002 cM |
| Genomic position | X: 12109166..12111300 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4024 | lgc-13(gk5097[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 2024 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATGAAAAAGATGTCTCTCCCGTGTATG ; Right flanking sequence: GCATTGGGCAATCTCATGTTTCATTTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |