Gene Information: igeg-2
| Name | igeg-2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F48C5.1 |
| Genetic position | X:3.75 +/- 0.000 cM |
| Genomic position | X: 11444350..11446635 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3033 | igeg-2(ve533[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| VC4007 | igeg-2(gk5080[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 1974 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGCTATTGTGTCACCGTTCCTCTGTCCA ; Right flanking sequence: ACAGGAATGAGGGAGTGTCAAGGAAAAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |