Gene Information: oig-5
| Name | oig-5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y57G11C.50 |
| Genetic position | IV:12.52 +/- 0.000 cM |
| Genomic position | IV: 14807203..14809961 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4000 | oig-5(gk5072[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 2650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTTCTCTGGTGGTAGCGATGATGGTAGAA; Right flanking sequence: GGCTGAAATCAATGCGTGGTAGCCTAAAGA. See WormBase Variation gk5072 for details. |