Gene Information: C46F4.3

NameC46F4.3 View on WormBase
Species C. elegans
SequenceC46F4.3
Genetic positionX:-4.04 +/- 0.000 cM
Genomic positionX: 5935773..5937614

Strains carrying this gene

Strain Genotype Description
RG3030 C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.