Gene Information: K06A9.3
| Name | K06A9.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K06A9.3 |
| Genetic position | X:-17.96 +/- 0.000 cM |
| Genomic position | X: 1534342..1535361 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3041 | K06A9.3(ve541[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |