Gene Information: C09F12.3
Name | C09F12.3 View on WormBase |
---|---|
Species | C. elegans |
Sequence | C09F12.3 |
Genetic position | X:2.86 +/- 0.000 cM |
Genomic position | X: 11040730..11042877 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
CGC81 | C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |