Gene Information: C09F12.3

NameC09F12.3 View on WormBase
Species C. elegans
SequenceC09F12.3
Genetic positionX:2.86 +/- 0.000 cM
Genomic positionX: 11040730..11042877

Strains carrying this gene

Strain Genotype Description
CGC81 C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.