Gene Information: ubc-6
| Name | ubc-6 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | D1022.1 |
| Genetic position | II:0.50 +/- 0.000 cM |
| Genomic position | II: 7479187..7480713 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3832 | ubc-6(gk3799[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 861 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CATGCACAACCAATGGAAGACAATCTTTTT; Right flanking sequence: TGGTATTCCAACACCACGCTCCCCGCTTGG. See WormBase Variation gk3799 for details. |