Gene Information: C40H5.7
| Name | C40H5.7 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | unknown |
| Genetic position | genetic position unknown or not listed |
| Genomic position | genomic coordinates unknown or not listed |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| RG3028 | C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |