Gene Information: grl-10
| Name | grl-10 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C26F1.5 |
| Genetic position | V:0.88 +/- 0.004 cM |
| Genomic position | V: 7774545..7775759 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4498 | grl-10(gk5569[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | Homozygous viable. Deletion of 1488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTGGCGATCGTCAGAATCTTCGGAGACCT; Right flanking sequence: AATCTCGACGAAGAAGATGAATTAATCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |