Gene Information: rap-3
| Name | rap-3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C08F8.7 |
| Genetic position | IV:4.92 +/- 0.001 cM |
| Genomic position | IV: 11177267..11178241 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| NK2503 | rap-3(qy57[rap-3::mNG]) IV. | Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124. |
| VC3737 | rap-3(gk3695[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details. |