Gene Information: dct-5
| Name | dct-5 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | F07F6.5 |
| Genetic position | II:-1.56 +/- 0.017 cM |
| Genomic position | II: 5435724..5436933 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4446 | dct-5(gk5521[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1067 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATGGCAACATAGTCGTCAGCGAGCTCCATG; Right flanking sequence: GAAGCTTCTCGTTTAGTTTTCCCACAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |