Gene Information: T04D3.8
Name | T04D3.8 View on WormBase |
---|---|
Species | C. elegans |
Sequence | T04D3.8 |
Genetic position | I:17.62 +/- 0.000 cM |
Genomic position | I: 13309988..13310711 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4402 | T04D3.8(gk5480[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 909 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GACGAAAAATCCAAATACATAACGAGACCC; Right flanking sequence: GGACTCAATTTCGACTATTTCCTGTTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |