Gene Information: T04D3.8
| Name | T04D3.8 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T04D3.8 |
| Genetic position | I:17.62 +/- 0.000 cM |
| Genomic position | I: 13309988..13310711 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4402 | T04D3.8(gk5480[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 909 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GACGAAAAATCCAAATACATAACGAGACCC; Right flanking sequence: GGACTCAATTTCGACTATTTCCTGTTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |