Gene Information: W01A8.6
| Name | W01A8.6 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | W01A8.6 |
| Genetic position | I:1.70 +/- 0.000 cM |
| Genomic position | I: 7070649..7074721 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4372 | W01A8.6(gk5453[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 2231 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTACTGTCTGCTGATGTTCCGTTTGTA; Right flanking sequence: CTCACCAGGAATAGGAGAAATGAAAATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |