Gene Information: igdb-1
Name | igdb-1 View on WormBase |
---|---|
Species | C. elegans |
Sequence | T04A11.3 |
Genetic position | IV:5.97 +/- 0.000 cM |
Genomic position | IV: 12479011..12482426 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC4330 | igdb-1(gk5413[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 7537 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACAGTTTCATTTTCAATTTCTTGTCCT; Right flanking sequence: TGTAATCTTATTTCTGTTCCATAGTCACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |