Gene Information: lgc-33
| Name | lgc-33 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | Y55F3BR.4 |
| Genetic position | IV:-23.25 +/- 0.026 cM |
| Genomic position | IV: 845498..848872 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4171 | lgc-33(gk5257[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTACTACCACTCGGCGGTGAGGCCCGCCG ; Right flanking sequence: CTCTAATGGATCTCTGGTTGTGTGCCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |