Gene Information: lgc-33

Namelgc-33 View on WormBase
Species C. elegans
SequenceY55F3BR.4
Genetic positionIV:-23.25 +/- 0.026 cM
Genomic positionIV: 845498..848872

Strains carrying this gene

Strain Genotype Description
VC4171 lgc-33(gk5257[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTACTACCACTCGGCGGTGAGGCCCGCCG ; Right flanking sequence: CTCTAATGGATCTCTGGTTGTGTGCCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.