Gene Information: C48B6.3
| Name | C48B6.3 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C48B6.3 |
| Genetic position | I:1.50 +/- 0.000 cM |
| Genomic position | I: 6915043..6916593 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC3977 | C48B6.3(gk5054[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 801 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGAGCTGTTCTTCGAGAACTGGCGGTGCCC; Right flanking sequence: AAATAACTCAACGACATCTCCAACGTCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |