Gene Information: ptr-13
| Name | ptr-13 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | K07C10.1 |
| Genetic position | II:3.33 +/- 0.002 cM |
| Genomic position | II: 11156589..11162481 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4125 | ptr-13(gk5205) II. | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT. |
| VC4160 | ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |