Gene Information: W04C9.5

NameW04C9.5 View on WormBase
Species C. elegans
SequenceW04C9.5
Genetic positionI:-19.03 +/- 0.000 cM
Genomic positionI: 462606..467137

Strains carrying this gene

Strain Genotype Description
VC3747 W04C9.5(gk3705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCCACATGGTGACCTAGGTTTACAGGTGGT; Right flanking sequence: AGGTATGCAACAACGCTCCATTGCTAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.