Gene Information: kin-24
Name | kin-24 View on WormBase |
---|---|
Species | C. elegans |
Sequence | K07F5.4 |
Genetic position | IV:4.43 +/- 0.000 cM |
Genomic position | IV: 9839057..9841084 |
Strains carrying this gene
Strain | Genotype | Description |
---|---|---|
VC3766 | kin-24(gk3724[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 978 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACATCACCGACTCGCGTGCAAAATCCG; Right flanking sequence: GGTTCCAGCAATGCAGGCTGTTCTCAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |