Gene Information: T21G5.2
| Name | T21G5.2 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | T21G5.2 |
| Genetic position | I:1.43 +/- 0.000 cM |
| Genomic position | I: 6870622..6870951 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4424 | T21G5.2(gk5502[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 1257 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGAACAAAAGTCTCAAAAATGCTTTCACC; Right flanking sequence: ACCGTATCAAATACGACATCAACACCATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |