Gene Information: lron-4
| Name | lron-4 View on WormBase |
|---|---|
| Species | C. elegans |
| Sequence | C41C4.3 |
| Genetic position | II:0.68 +/- 0.000 cM |
| Genomic position | II: 8108937..8112163 |
Strains carrying this gene
| Strain | Genotype | Description |
|---|---|---|
| VC4026 | lron-4(gk5099[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 2314 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CACGTTGCTCTCACAACTTGCATTCCGCAG ; Right flanking sequence: ATTGGTTTTTATAGTTATTAGTATTACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |