Gene Information: lron-4

Namelron-4 View on WormBase
Species C. elegans
SequenceC41C4.3
Genetic positionII:0.68 +/- 0.000 cM
Genomic positionII: 8108937..8112163

Strains carrying this gene

Strain Genotype Description
VC4026 lron-4(gk5099[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Homozygous viable. Deletion of 2314 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CACGTTGCTCTCACAACTTGCATTCCGCAG ; Right flanking sequence: ATTGGTTTTTATAGTTATTAGTATTACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.